Sequence retrieval

Genome: Bacillus megaterium WSH-002
Start position: 3513746
End position: 3513769
Length: 24

DNA sequence
>NC_017138, from 3513746 to 3513769 (24 bp); Bacillus megaterium WSH-002 TGCTTTTTCTTTGGCTTTTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3513147-3514145	Sequence	BMWSH_3749 dppD Oligopeptide/dipeptide ABC transporter, ATPase subunit (Protein is coded in complementary strand; from 3514145 to 3513147)