Sequence retrieval

Genome: Bacillus megaterium WSH-002
Start position: 3250209
End position: 3250238
Length: 30

DNA sequence
>NC_017138, from 3250209 to 3250238 (30 bp); Bacillus megaterium WSH-002 TTATCAATATCATTATCGTTGTCATTATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3250188-3251219	Sequence	BMWSH_3462 recA recombinase A (Protein is coded in complementary strand; from 3251219 to 3250188)