Sequence retrieval

Genome: Bacillus megaterium WSH-002
Start position: 3176980
End position: 3177007
Length: 28

DNA sequence
>NC_017138, from 3176980 to 3177007 (28 bp); Bacillus megaterium WSH-002 CTTTTTTCTTTTTTCTTTCTTCTTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3176736-3178703	Sequence	BMWSH_3388 qoxB Quinol oxidase polypeptide I (Protein is coded in complementary strand; from 3178703 to 3176736)