Sequence retrieval

Genome: Bacillus megaterium WSH-002
Start position: 2709019
End position: 2709042
Length: 24

DNA sequence
>NC_017138, from 2709019 to 2709042 (24 bp); Bacillus megaterium WSH-002 TCAATTTCCATTTCCATTTCAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2708980-2710176	Sequence	BMWSH_2885 dadA Uncharacterized oxidoreductase yurR (Protein is coded in complementary strand; from 2710176 to 2708980)