Sequence retrieval

Genome: Bacillus megaterium WSH-002
Start position: 2692558
End position: 2692582
Length: 25

DNA sequence
>NC_017138, from 2692558 to 2692582 (25 bp); Bacillus megaterium WSH-002 ATTTCAATTCCTTTCATTGCACTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2692513-2693397	Sequence	BMWSH_2868 - pyridoxal biosynthesis lyase pdxS (Protein is coded in complementary strand; from 2693397 to 2692513)