Sequence retrieval

Genome: Bacillus megaterium WSH-002
Start position: 2481721
End position: 2481747
Length: 27

DNA sequence
>NC_017138, from 2481721 to 2481747 (27 bp); Bacillus megaterium WSH-002 AGGAGCTTGAGGAGCCTGAGGAGCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2481407-2481889	Sequence	BMWSH_2637 yocM Spore coat protein P (Protein is coded in complementary strand; from 2481889 to 2481407)