Sequence retrieval

Genome: Bacillus megaterium WSH-002
Start position: 2323147
End position: 2323170
Length: 24

DNA sequence
>NC_017138, from 2323147 to 2323170 (24 bp); Bacillus megaterium WSH-002 ATGAAAATGGAAATGAAGCTGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2323096-2323215	Sequence	BMWSH_2475 - hypothetical protein (Protein is coded in complementary strand; from 2323215 to 2323096)