Sequence retrieval

Genome: Bacillus megaterium WSH-002
Start position: 2063587
End position: 2063610
Length: 24

DNA sequence
>NC_017138, from 2063587 to 2063610 (24 bp); Bacillus megaterium WSH-002 AGAATTAGAACTAGAACTAGAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2063543-2063731	Sequence	BMWSH_2201 - hypothetical protein (Protein is coded in complementary strand; from 2063731 to 2063543)