Sequence retrieval

Genome: Bacillus megaterium WSH-002
Start position: 2057807
End position: 2057831
Length: 25

DNA sequence
>NC_017138, from 2057807 to 2057831 (25 bp); Bacillus megaterium WSH-002 ATTAAATTATATTCATTTAAAATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2057393-2058025	Sequence	BMWSH_2191 yhcQ Spore coat protein F-like protein yhcQ (Protein is coded in complementary strand; from 2058025 to 2057393)