Sequence retrieval

Genome: Bacillus megaterium WSH-002
Start position: 108606
End position: 108641
Length: 36

DNA sequence
>NC_017138, from 108606 to 108641 (36 bp); Bacillus megaterium WSH-002 GATTTAGAAGATGATCTAGACGATGATGAAGAAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 108181-108678	Sequence	BMWSH_0102 rpoE DNA-directed RNA polymerase delta subunit (RNAP delta factor)