Sequence retrieval

Genome: Marinobacter hydrocarbonoclasticus ATCC 49840
Start position: 3435018
End position: 3435071
Length: 54

DNA sequence
>NC_017067, from 3435018 to 3435071 (54 bp); Marinobacter hydrocarbonoclasticus ATCC 49840 GTTGTCGGAATTATCGGAGTTGTCAGAGTTATCTGAGTTGTCCGAATTGTCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3434638-3435705	Sequence	MARHY3349 - hypothetical protein (Protein is coded in complementary strand; from 3435705 to 3434638)