Sequence retrieval

Genome: Marinobacter hydrocarbonoclasticus ATCC 49840
Start position: 202456
End position: 202491
Length: 36

DNA sequence
>NC_017067, from 202456 to 202491 (36 bp); Marinobacter hydrocarbonoclasticus ATCC 49840 TCTGGTTTGGGCTCTGGTTTGGGTTCTGGCTTGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 201970-202725	Sequence	MARHY0180 - putative TonB, C-terminal precursor (Protein is coded in complementary strand; from 202725 to 201970)