Sequence retrieval

Genome: Marinobacter hydrocarbonoclasticus ATCC 49840
Start position: 967203
End position: 967226
Length: 24

DNA sequence
>NC_017067, from 967203 to 967226 (24 bp); Marinobacter hydrocarbonoclasticus ATCC 49840 GACCTGGACCAGGTCCTGGGCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 966928-967662	Sequence	MARHY0925 rstA two component system DNA-binding response regulator