Sequence retrieval

Genome: Marinobacter hydrocarbonoclasticus ATCC 49840
Start position: 2817059
End position: 2817082
Length: 24

DNA sequence
>NC_017067, from 2817059 to 2817082 (24 bp); Marinobacter hydrocarbonoclasticus ATCC 49840 TGTCACTATCACTGTCACTGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2815246-2817261	Sequence	MARHY2732 - hypothetical protein (Protein is coded in complementary strand; from 2817261 to 2815246)