Sequence retrieval

Genome: Marinobacter hydrocarbonoclasticus ATCC 49840
Start position: 2760363
End position: 2760386
Length: 24

DNA sequence
>NC_017067, from 2760363 to 2760386 (24 bp); Marinobacter hydrocarbonoclasticus ATCC 49840 CCATCACCATCCCGATCACCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2760062-2762047	Sequence	MARHY2685 - putative integral membrane protein, transporter precursor (Protein is coded in complementary strand; from 2762047 to 2760062)