Sequence retrieval

Genome: Marinobacter hydrocarbonoclasticus ATCC 49840
Start position: 2424215
End position: 2424238
Length: 24

DNA sequence
>NC_017067, from 2424215 to 2424238 (24 bp); Marinobacter hydrocarbonoclasticus ATCC 49840 CCAGCCCGCCAGCTCGGCAGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2423775-2425973	Sequence	MARHY2382 - Membrane-bound aldehyde dehydrogenase (Protein is coded in complementary strand; from 2425973 to 2423775)