Sequence retrieval

Genome: Marinobacter hydrocarbonoclasticus ATCC 49840
Start position: 2109945
End position: 2109968
Length: 24

DNA sequence
>NC_017067, from 2109945 to 2109968 (24 bp); Marinobacter hydrocarbonoclasticus ATCC 49840 GGCCCTGGCCCGGGCGCTGGCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2109491-2110285	Sequence	MARHY2067 - ATPas precursor of the ABC transport system