Sequence retrieval

Genome: Marinobacter hydrocarbonoclasticus ATCC 49840
Start position: 1864658
End position: 1864681
Length: 24

DNA sequence
>NC_017067, from 1864658 to 1864681 (24 bp); Marinobacter hydrocarbonoclasticus ATCC 49840 GTGCTGGTGATGGTGCCGGTGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1864065-1865021	Sequence	MARHY1789 desC delta 9 acyl-lipid fatty acid desaturase (Protein is coded in complementary strand; from 1865021 to 1864065)