Sequence retrieval

Genome: Rickettsia typhi str. TH1527
Start position: 806459
End position: 806485
Length: 27

DNA sequence
>NC_017066, from 806459 to 806485 (27 bp); Rickettsia typhi str. TH1527 CCATACCACCCATACCACCCATGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 806452-808104	Sequence	RTTH1527_02970 groEL chaperonin GroEL (Protein is coded in complementary strand; from 808104 to 806452)