Sequence retrieval

Genome: Rickettsia typhi str. TH1527
Start position: 455956
End position: 455982
Length: 27

DNA sequence
>NC_017066, from 455956 to 455982 (27 bp); Rickettsia typhi str. TH1527 AAAATGAATGAAATGAATAAAATAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 455960-458263	Sequence	RTTH1527_01765 - bifunctional malic enzyme oxidoreductase/phosphotransacetylase