Sequence retrieval

Genome: Rickettsia typhi str. TH1527
Start position: 426852
End position: 426881
Length: 30

DNA sequence
>NC_017066, from 426852 to 426881 (30 bp); Rickettsia typhi str. TH1527 ATATTAATATTTGTATTAATATTCATAGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 426561-429056	Sequence	RTTH1527_01645 - outer membrane assembly protein (Protein is coded in complementary strand; from 429056 to 426561)