Sequence retrieval

Genome: Helicobacter pylori ELS37
Start position: 976461
End position: 976484
Length: 24

DNA sequence
>NC_017063, from 976461 to 976484 (24 bp); Helicobacter pylori ELS37 TTTTCACTTTCATTTTCTGTTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 974307-977147	Sequence	HPELS_04755 infB translation initiation factor IF-2 (Protein is coded in complementary strand; from 977147 to 974307)