Sequence retrieval

Genome: Helicobacter pylori ELS37
Start position: 92207
End position: 92233
Length: 27

DNA sequence
>NC_017063, from 92207 to 92233 (27 bp); Helicobacter pylori ELS37 TTCTTCGTTTTCTTCGTCTTCTTCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 90948-92960	Sequence	HPELS_00455 - RNA polymerase sigma factor RpoD (Protein is coded in complementary strand; from 92960 to 90948)