Sequence retrieval

Genome: Helicobacter pylori ELS37
Start position: 867392
End position: 867415
Length: 24

DNA sequence
>NC_017063, from 867392 to 867415 (24 bp); Helicobacter pylori ELS37 TCATCTTCATATTCTTCTTCATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 867011-867676	Sequence	HPELS_04230 - hypothetical protein (Protein is coded in complementary strand; from 867676 to 867011)