Sequence retrieval

Genome: Helicobacter pylori ELS37
Start position: 699386
End position: 699421
Length: 36

DNA sequence
>NC_017063, from 699386 to 699421 (36 bp); Helicobacter pylori ELS37 AAAGCGTGCAAAAAATCGCGCAAAAAATCGCGCAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 698747-700990	Sequence	HPELS_03445 - recombination and DNA strand exchange inhibitor protein