Sequence retrieval

Genome: Helicobacter pylori ELS37
Start position: 685925
End position: 685954
Length: 30

DNA sequence
>NC_017063, from 685925 to 685954 (30 bp); Helicobacter pylori ELS37 CAAAGCGCTTCAAACCACTTAAAAGCGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 685766-686440	Sequence	HPELS_03380 - Ni/Fe-hydrogenase, b-type cytochrome subunit (Protein is coded in complementary strand; from 686440 to 685766)