Sequence retrieval

Genome: Helicobacter pylori ELS37
Start position: 665149
End position: 665193
Length: 45

DNA sequence
>NC_017063, from 665149 to 665193 (45 bp); Helicobacter pylori ELS37 TTTTGAGCTTCATTTTTTTGAGTCTCACTTTTTTGAGCCTCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 662572-665352	Sequence	HPELS_03260 - protective surface antigen D15 (Protein is coded in complementary strand; from 665352 to 662572)