Sequence retrieval

Genome: Helicobacter pylori ELS37
Start position: 269050
End position: 269085
Length: 36

DNA sequence
>NC_017063, from 269050 to 269085 (36 bp); Helicobacter pylori ELS37 TCAAGGGCTTAGACAAGGACTTAGGCAAGGACTTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 268509-269252	Sequence	HPELS_01365 - hypothetical protein (Protein is coded in complementary strand; from 269252 to 268509)