Sequence retrieval

Genome: Helicobacter pylori ELS37
Start position: 1573735
End position: 1573762
Length: 28

DNA sequence
>NC_017063, from 1573735 to 1573762 (28 bp); Helicobacter pylori ELS37 AATTTTCAATTTTCAATTTTCAATTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1573755-1575626	Sequence	HPELS_07840 - ATP-dependent DNA helicase RecG (Protein is coded in complementary strand; from 1575626 to 1573755)