Sequence retrieval

Genome: Helicobacter pylori ELS37
Start position: 1193794
End position: 1193823
Length: 30

DNA sequence
>NC_017063, from 1193794 to 1193823 (30 bp); Helicobacter pylori ELS37 GGTTGGGATTGGTGGGGTTTGGTTGGGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1193771-1194481	Sequence	HPELS_05870 - hypothetical protein (Protein is coded in complementary strand; from 1194481 to 1193771)