Sequence retrieval

Genome: Helicobacter pylori ELS37
Start position: 1117031
End position: 1117054
Length: 24

DNA sequence
>NC_017063, from 1117031 to 1117054 (24 bp); Helicobacter pylori ELS37 TTTCCTTTTCTTTTTGCTTTTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1116952-1117380	Sequence	HPELS_05480 - hypothetical protein (Protein is coded in complementary strand; from 1117380 to 1116952)