Sequence retrieval

Genome: Helicobacter pylori ELS37
Start position: 1090162
End position: 1090188
Length: 27

DNA sequence
>NC_017063, from 1090162 to 1090188 (27 bp); Helicobacter pylori ELS37 GATATTAGGGATATTGGGGATATTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1088957-1090528	Sequence	HPELS_05325 - hypothetical protein (Protein is coded in complementary strand; from 1090528 to 1088957)