Sequence retrieval

Genome: Helicobacter pylori ELS37
Start position: 1059878
End position: 1059904
Length: 27

DNA sequence
>NC_017063, from 1059878 to 1059904 (27 bp); Helicobacter pylori ELS37 CATCGCCTCCATCGCCCCCATCGCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1058926-1060008	Sequence	HPELS_05215 obgE GTPase CgtA (Protein is coded in complementary strand; from 1060008 to 1058926)