Sequence retrieval

Genome: Riemerella anatipestifer DSM 15868
Start position: 203227
End position: 203256
Length: 30

DNA sequence
>NC_017045, from 203227 to 203256 (30 bp); Riemerella anatipestifer DSM 15868 AGAATAAAATAGAAATAAATAAAATAAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 202728-203267	Sequence	RA0C_0242 - ankyrin (Protein is coded in complementary strand; from 203267 to 202728)