Sequence retrieval

Genome: Riemerella anatipestifer DSM 15868
Start position: 365669
End position: 365693
Length: 25

DNA sequence
>NC_017045, from 365669 to 365693 (25 bp); Riemerella anatipestifer DSM 15868 AAAAAAGAAAGAAAAAAAGAAAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 365594-366133	Sequence	RA0C_0402 - hypothetical protein (Protein is coded in complementary strand; from 366133 to 365594)