Sequence retrieval

Genome: Riemerella anatipestifer DSM 15868
Start position: 1630381
End position: 1630405
Length: 25

DNA sequence
>NC_017045, from 1630381 to 1630405 (25 bp); Riemerella anatipestifer DSM 15868 CTTTTCTTCTCTTTCCTTTTCTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1630364-1631248	Sequence	RA0C_1616 - outer membrane assembly lipoprotein yfio (Protein is coded in complementary strand; from 1631248 to 1630364)