Sequence retrieval

Genome: Riemerella anatipestifer DSM 15868
Start position: 943390
End position: 943413
Length: 24

DNA sequence
>NC_017045, from 943390 to 943413 (24 bp); Riemerella anatipestifer DSM 15868 TGCCGCTGCTGCTGCCGTTGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 943134-943817	Sequence	RA0C_0963 - peptidase membrane zinc metallopeptidase