Sequence retrieval

Genome: Riemerella anatipestifer DSM 15868
Start position: 834696
End position: 834719
Length: 24

DNA sequence
>NC_017045, from 834696 to 834719 (24 bp); Riemerella anatipestifer DSM 15868 CTTTATCTTCATCTTTAAGTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 832379-837031	Sequence	RA0C_0858 - DNA polymerase iii, alpha subunit (Protein is coded in complementary strand; from 837031 to 832379)