Sequence retrieval

Genome: Riemerella anatipestifer DSM 15868
Start position: 769492
End position: 769515
Length: 24

DNA sequence
>NC_017045, from 769492 to 769515 (24 bp); Riemerella anatipestifer DSM 15868 ATTTATATTTCTATTCATATTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 769364-769909	Sequence	RA0C_0798 - hypothetical protein (Protein is coded in complementary strand; from 769909 to 769364)