Sequence retrieval

Genome: Riemerella anatipestifer DSM 15868
Start position: 699669
End position: 699692
Length: 24

DNA sequence
>NC_017045, from 699669 to 699692 (24 bp); Riemerella anatipestifer DSM 15868 AGTTTTACTTTTAGGTTTTGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 698736-700226	Sequence	RA0C_0725 - hypothetical protein (Protein is coded in complementary strand; from 700226 to 698736)