Sequence retrieval

Genome: Riemerella anatipestifer DSM 15868
Start position: 215324
End position: 215347
Length: 24

DNA sequence
>NC_017045, from 215324 to 215347 (24 bp); Riemerella anatipestifer DSM 15868 GTTATTATTATTATTATTATTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 215344-216108	Sequence	RA0C_0254 - port protein (Protein is coded in complementary strand; from 216108 to 215344)