Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 8559063
End position: 8559086
Length: 24

DNA sequence
>NC_016935, from 8559063 to 8559086 (24 bp); Paenibacillus mucilaginosus 3016 CGGCTTCTGCTTCAGCTTCGCCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8557915-8559492	Sequence	PM3016_7319 - hypothetical protein (Protein is coded in complementary strand; from 8559492 to 8557915)