Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 8028912
End position: 8028935
Length: 24

DNA sequence
>NC_016935, from 8028912 to 8028935 (24 bp); Paenibacillus mucilaginosus 3016 CCCTGACCCTGACCCTGACCCTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8028250-8028951	Sequence	PM3016_6824 - hypothetical protein (Protein is coded in complementary strand; from 8028951 to 8028250)