Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 8021003
End position: 8021038
Length: 36

DNA sequence
>NC_016935, from 8021003 to 8021038 (36 bp); Paenibacillus mucilaginosus 3016 TCTGAACATAATTCCGAACACAATTTTGAACATAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8020639-8021067	Sequence	PM3016_6817 - hypothetical protein (Protein is coded in complementary strand; from 8021067 to 8020639)