Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 8018627
End position: 8018650
Length: 24

DNA sequence
>NC_016935, from 8018627 to 8018650 (24 bp); Paenibacillus mucilaginosus 3016 GTTTTCGTTCTCGTTGTCGGTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8017160-8018665	Sequence	PM3016_6814 - RNA methyltransferase (Protein is coded in complementary strand; from 8018665 to 8017160)
ORF. 8018604-8019629	Sequence	PM3016_6815 - putative lipid kinase (Protein is coded in complementary strand; from 8019629 to 8018604)