Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 7940748
End position: 7940771
Length: 24

DNA sequence
>NC_016935, from 7940748 to 7940771 (24 bp); Paenibacillus mucilaginosus 3016 TCCGACACTCCGACACTCCGACAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7940643-7940834	Sequence	PM3016_6739 - hypothetical protein (Protein is coded in complementary strand; from 7940834 to 7940643)