Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 7729143
End position: 7729166
Length: 24

DNA sequence
>NC_016935, from 7729143 to 7729166 (24 bp); Paenibacillus mucilaginosus 3016 CTCCGCCTTCGCCTCCGCTTCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7728652-7730019	Sequence	PM3016_6554 - hypothetical protein (Protein is coded in complementary strand; from 7730019 to 7728652)