Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 7612530
End position: 7612574
Length: 45

DNA sequence
>NC_016935, from 7612530 to 7612574 (45 bp); Paenibacillus mucilaginosus 3016 GTGGTCATGATGGTGATGATCATGATTGTGGTCGTGATGATGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7612351-7613415	Sequence	PM3016_6450 - sirohydrochlorin cobaltochelatase (Protein is coded in complementary strand; from 7613415 to 7612351)