Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 7591930
End position: 7591953
Length: 24

DNA sequence
>NC_016935, from 7591930 to 7591953 (24 bp); Paenibacillus mucilaginosus 3016 AGCTCCAGCTGCAGCTCAAGCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7588882-7593069	Sequence	PM3016_6432 - hypothetical protein (Protein is coded in complementary strand; from 7593069 to 7588882)