Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 7543650
End position: 7543673
Length: 24

DNA sequence
>NC_016935, from 7543650 to 7543673 (24 bp); Paenibacillus mucilaginosus 3016 ATCTCCATCTCTATCTTCATCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7542813-7543676	Sequence	PM3016_6386 - hypothetical protein (Protein is coded in complementary strand; from 7543676 to 7542813)